View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14315_low_37 (Length: 270)

Name: NF14315_low_37
Description: NF14315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14315_low_37
NF14315_low_37
[»] chr8 (1 HSPs)
chr8 (109-187)||(3208947-3209025)


Alignment Details
Target: chr8 (Bit Score: 79; Significance: 5e-37; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 109 - 187
Target Start/End: Complemental strand, 3209025 - 3208947
Alignment:
Q  109 ctgattgagatctgattcgttagatgatgatttgtaattttgtatccaatttagcaattcagcttttattacagatccc 187  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3209025 ctgattgagatctgattcgttagatgatgatttgtaattttgtatccaatttagcaattcagcttttattacagatccc 3208947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University