View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14315_high_27 (Length: 331)

Name: NF14315_high_27
Description: NF14315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14315_high_27
NF14315_high_27
[»] chr3 (1 HSPs)
chr3 (15-242)||(47351735-47351962)


Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 15 - 242
Target Start/End: Original strand, 47351735 - 47351962
Alignment:
Q  15 tctcgacagaggatggaaaatgggtggactagaagaactttcttagattattagagtgttaatcaataagagctgataattggaacacatgatttagtat 114  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||    
T  47351735 tctcggcagaggatggaaaatgggtggactagaagaactttcttagattattagagagttaatcaataagagcttataattggaacacatgatttagtat 47351834  T
Q  115 tttaaaccatactcctgctctctagattcgttatattcatccggctttgagtttttaatctgatatgaaaaagtctaatggcgtcacaaattactgtgaa 214  Q
    ||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  47351835 tttaaaccatactcctgctttctagattccttatattcatccggctttgagtttttaatctgatatgaaaaagtctaatggcgtcacaaattactgtgaa 47351934  T
Q  215 gtgattgctttgcaagcttctgttgatt 242  Q
    |||||||||| |||||||||||||||||    
T  47351935 gtgattgcttggcaagcttctgttgatt 47351962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University