View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1430_low_25 (Length: 242)

Name: NF1430_low_25
Description: NF1430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1430_low_25
NF1430_low_25
[»] chr7 (2 HSPs)
chr7 (131-226)||(5188887-5188983)
chr7 (13-89)||(5188778-5188854)


Alignment Details
Target: chr7 (Bit Score: 77; Significance: 7e-36; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 131 - 226
Target Start/End: Original strand, 5188887 - 5188983
Alignment:
Q  131 cccatcaagtaattagtgaatttgtggtcaaaaagactcacaaaaacaaatggcatagcaccat-aagtatgatatagaataaagactgcaaaactg 226  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||  ||||||||||||||||    
T  5188887 cccatcaagtaattagcgaatttgtggtcaaaaagactcacaaaaacaaatggcatagcaccatcaagtatgatatagagcaaagactgcaaaactg 5188983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 13 - 89
Target Start/End: Original strand, 5188778 - 5188854
Alignment:
Q  13 agcaaaggctctcaaatttatgccttgggatgttttcaagttgaaggaattgttcttggatgttatccaatttcaag 89  Q
    |||| |||| ||||||||||||||||  ||||||||||||||||||||||||| |||||||||||||||||||||||    
T  5188778 agcagaggcgctcaaatttatgccttaagatgttttcaagttgaaggaattgtgcttggatgttatccaatttcaag 5188854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University