View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14307_low_108 (Length: 233)

Name: NF14307_low_108
Description: NF14307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14307_low_108
NF14307_low_108
[»] chr5 (2 HSPs)
chr5 (133-223)||(9015157-9015245)
chr5 (1-71)||(9015025-9015095)


Alignment Details
Target: chr5 (Bit Score: 80; Significance: 1e-37; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 133 - 223
Target Start/End: Original strand, 9015157 - 9015245
Alignment:
Q  133 gacccatcaaaataagtttccccattgaggcccctgcttctagtaatggcaaaagcacatattcatctttcatacattcccctgtcctttg 223  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||    
T  9015157 gacccatcaaaataagtttccccattgaggcccctgcttctagtaatggcaaaagcac--attcatctttcatacattcccctgtcctttg 9015245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 71
Target Start/End: Original strand, 9015025 - 9015095
Alignment:
Q  1 actagtatatgctttttggtcacgcttttaatcctttcctttcttcacttgccacatgaagataattttgt 71  Q
    |||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||    
T  9015025 actagtatatgctttttggtcacgcttttaatcctttcctctcttcactttccacatgaagataattttgt 9015095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University