View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14304_low_28 (Length: 235)

Name: NF14304_low_28
Description: NF14304
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14304_low_28
NF14304_low_28
[»] chr7 (2 HSPs)
chr7 (21-123)||(23036969-23037065)
chr7 (186-221)||(23036555-23036590)


Alignment Details
Target: chr7 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 21 - 123
Target Start/End: Complemental strand, 23037065 - 23036969
Alignment:
Q  21 tgtggagtgcatctaatatcaacatcaaaatattagtttaaaggtagacttacacttaccttttaatttaaatagaacattatactttacctctttcttc 120  Q
    ||||||||||||||||||||||| ||||||||||||| |||||||||||||||      |||||||||||||||||||||||||||||| ||||||||||    
T  23037065 tgtggagtgcatctaatatcaacttcaaaatattagtgtaaaggtagacttac------cttttaatttaaatagaacattatactttatctctttcttc 23036972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 186 - 221
Target Start/End: Complemental strand, 23036590 - 23036555
Alignment:
Q  186 gggttcatattaaaatacgttttttgtgacattttt 221  Q
    ||||||||||||||||||||||||||||||||||||    
T  23036590 gggttcatattaaaatacgttttttgtgacattttt 23036555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University