View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14300_low_57 (Length: 213)

Name: NF14300_low_57
Description: NF14300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14300_low_57
NF14300_low_57
[»] chr7 (1 HSPs)
chr7 (12-195)||(36273191-36273376)
[»] chr4 (1 HSPs)
chr4 (33-83)||(49351816-49351866)


Alignment Details
Target: chr7 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 12 - 195
Target Start/End: Original strand, 36273191 - 36273376
Alignment:
Q  12 gagagagatgaattactcacgtgtgattaatttagatgtgataggaagggaacatgataaagaaaagatcataaagcatttgattcaacatgataattat 111  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  36273191 gagagagatgaattactcacgtgtgattaattcagatgtgataggaagggaacatgataaagaaaagatcataaagcatttgattcaacatgataattat 36273290  T
Q  112 caaaa--tttctgttgtccctattgtggggtttcggggcgtgggaaagactacacttgcaaagcttgtgttcaataatgagagaat 195  Q
    |||||  | ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||    
T  36273291 caaaatctctctgttgtccctattgtggggtttcggagcgtgggaaagactacacttgcaaagcttgtgttcaatgatgagagaat 36273376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 33 - 83
Target Start/End: Original strand, 49351816 - 49351866
Alignment:
Q  33 tgtgattaatttagatgtgataggaagggaacatgataaagaaaagatcat 83  Q
    ||||||| |||  ||||||||||||||||||||||||||| |||| |||||    
T  49351816 tgtgattgattctgatgtgataggaagggaacatgataaacaaaaaatcat 49351866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University