View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14300_low_48 (Length: 238)

Name: NF14300_low_48
Description: NF14300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14300_low_48
NF14300_low_48
[»] chr8 (1 HSPs)
chr8 (17-238)||(34490253-34490474)


Alignment Details
Target: chr8 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 17 - 238
Target Start/End: Complemental strand, 34490474 - 34490253
Alignment:
Q  17 atatttatctatttaattagtgttttaggacattagttagaatttttcttatgaaatttgttaaccaaagcctcgttaagcttcaaacaaagagaggaat 116  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||      |    
T  34490474 atatttatctatttaattagtgtcttaggacattagttagaatttttcttatgaaatttgttaaccaaagcctcgttaagcttcaaacaaaga------t 34490381  T
Q  117 ccgtgtag-taaggag-----acataaatcctcttgcctcaacccacgagtacgactgtttatcccgctactcattgtttctctttagagattagtgcaa 210  Q
      ||| |  | | |||     | ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
T  34490380 tagtgcaacttacgaggtttcaaataaatcctcttgcctcaacccacgagtacgactgtttatccctctactcattgtttctctttagagattagtgcaa 34490281  T
Q  211 cttattaatgattattttgttactgtat 238  Q
    ||||||||||||||||||||||||||||    
T  34490280 cttattaatgattattttgttactgtat 34490253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University