View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14296_high_14 (Length: 249)

Name: NF14296_high_14
Description: NF14296
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14296_high_14
NF14296_high_14
[»] chr3 (2 HSPs)
chr3 (144-249)||(54798551-54798656)
chr3 (95-126)||(54798674-54798705)


Alignment Details
Target: chr3 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 144 - 249
Target Start/End: Complemental strand, 54798656 - 54798551
Alignment:
Q  144 tagcaccatgtgacaaaaccacatgttcaatgtatgacttgccattaatttaatgaagttttcaggtaaaagtagtcacagaaattaacatggcatatgc 243  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  54798656 tagcaccatgtgacaaaaccacatgttcaatgtatgacttgccattaatttaatgaggttttcaggtaaaagtagtcacagaaattaacatggcatatgc 54798557  T
Q  244 aaacca 249  Q
    ||||||    
T  54798556 aaacca 54798551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 95 - 126
Target Start/End: Complemental strand, 54798705 - 54798674
Alignment:
Q  95 tctaatcatgttcaatgtatgtatgaccttgt 126  Q
    ||||||||||||||||||||||||||||||||    
T  54798705 tctaatcatgttcaatgtatgtatgaccttgt 54798674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University