View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14294_low_21 (Length: 227)

Name: NF14294_low_21
Description: NF14294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14294_low_21
NF14294_low_21
[»] chr7 (2 HSPs)
chr7 (18-136)||(40385237-40385355)
chr7 (172-212)||(40385195-40385235)


Alignment Details
Target: chr7 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 18 - 136
Target Start/End: Complemental strand, 40385355 - 40385237
Alignment:
Q  18 atgtaaaggactgcaggcagacataattttgattgagttgtgttcaaagctaaacgcataaaagtaataatgtaaggtgcatataatctcgnnnnnnnac 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        |    
T  40385355 atgtaaaggactgcaggcagacataattttgattgagttgtgttcaaagctaaacgcataaaagtaataatgtaaggtgcatataatctcgttttttttc 40385256  T
Q  118 tatttctttcaagctaaca 136  Q
    |||||||||||||||||||    
T  40385255 tatttctttcaagctaaca 40385237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 172 - 212
Target Start/End: Complemental strand, 40385235 - 40385195
Alignment:
Q  172 tgttgtgaaaatggaaattaaaacatgaaaaagtaatagtt 212  Q
    |||||||||||||||||||||||||||||||||||||||||    
T  40385235 tgttgtgaaaatggaaattaaaacatgaaaaagtaatagtt 40385195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University