View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14288_low_12 (Length: 230)

Name: NF14288_low_12
Description: NF14288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14288_low_12
NF14288_low_12
[»] chr7 (1 HSPs)
chr7 (13-214)||(43031164-43031362)
[»] chr4 (1 HSPs)
chr4 (137-191)||(46527159-46527213)


Alignment Details
Target: chr7 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 13 - 214
Target Start/End: Complemental strand, 43031362 - 43031164
Alignment:
Q  13 caaaggccaaagcgaacaatcacgtatagatttacaataccatacgtgtatggtttttgtttgagaggaagttcttatatgtatttacaatacatacgca 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43031362 caaaggccaaagcgaacaatcacgtatagatttacaataccatacgtgtatggtttttgtttgagaggaagttcttatatgtatttacaatacatacgca 43031263  T
Q  113 tgctatgttcattgtcactagtactgaagcttcaccagaacactgagttgggaaagaagcaccctgtttatgatggtgcgaggaatttttacactcctag 212  Q
    | |||||||||||||||||||   ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
T  43031262 tactatgttcattgtcactag---tgaagcttcaccagaacactgagttgggaaagaagcaccctgtttatgatggtgcgaggaatttttacactgctag 43031166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 137 - 191
Target Start/End: Original strand, 46527159 - 46527213
Alignment:
Q  137 tgaagcttcaccagaacactgagttgggaaagaagcaccctgtttatgatggtgc 191  Q
    ||||| |||||||||||||||| ||||||||||||| ||||||||||||||||||    
T  46527159 tgaagtttcaccagaacactgaattgggaaagaagctccctgtttatgatggtgc 46527213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University