View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14271_low_32 (Length: 239)

Name: NF14271_low_32
Description: NF14271
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14271_low_32
NF14271_low_32
[»] chr6 (3 HSPs)
chr6 (1-124)||(8390502-8390625)
chr6 (94-151)||(8421491-8421548)
chr6 (23-51)||(8421418-8421446)


Alignment Details
Target: chr6 (Bit Score: 116; Significance: 4e-59; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 1 - 124
Target Start/End: Complemental strand, 8390625 - 8390502
Alignment:
Q  1 catgtcttccgttttcttcgatttttctgtcttctacctaaacagtctatttggttacaacttacaaaactattagtttgatcatttgtgatacttgatt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
T  8390625 catgtcttccgttttcttcgatttttctgtcttctacctaaacagtctatttggttacaacttacaaaacaattagtttgatcatttgtgatacttgatt 8390526  T
Q  101 gatatcaaattcctattatgttta 124  Q
    ||||||||||||||||||| ||||    
T  8390525 gatatcaaattcctattatcttta 8390502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 94 - 151
Target Start/End: Original strand, 8421491 - 8421548
Alignment:
Q  94 cttgattgatatcaaattcctattatgtttatgccatgtcaattttcctcttgctgtt 151  Q
    |||||||||||| || ||||| ||||||| |||||  |||||||||||||||| ||||    
T  8421491 cttgattgatatgaacttcctcttatgttaatgcctcgtcaattttcctcttgttgtt 8421548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 23 - 51
Target Start/End: Original strand, 8421418 - 8421446
Alignment:
Q  23 ttttctgtcttctacctaaacagtctatt 51  Q
    |||||||||||||||||||||||||||||    
T  8421418 ttttctgtcttctacctaaacagtctatt 8421446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University