View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14267_low_58 (Length: 253)

Name: NF14267_low_58
Description: NF14267
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14267_low_58
NF14267_low_58
[»] chr4 (1 HSPs)
chr4 (18-188)||(27574905-27575075)


Alignment Details
Target: chr4 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 18 - 188
Target Start/End: Complemental strand, 27575075 - 27574905
Alignment:
Q  18 aaaagaagtaactttctagtcagtgaagaaaacaaatgttctttatatttttctttgaattaagcgttcttttgattttctcgaccaatccataaactag 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||    
T  27575075 aaaagaagtaactttctagtcagtgaagaaaacaaatgttctttatatttttctttcaattaaacgttcttttgattttctcgaccaatccataaactag 27574976  T
Q  118 gccgggcagcaaactagtatgtctggatatgggaatgtgcaccttccatgtgttgaatgatatatagatag 188  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
T  27574975 gccgggcagcaaactagtatggctggatatgggaatgtgcaccttccatgtgttgaatgatatatagatag 27574905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University