View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14261_low_6 (Length: 215)

Name: NF14261_low_6
Description: NF14261
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14261_low_6
NF14261_low_6
[»] chr5 (1 HSPs)
chr5 (18-126)||(8963397-8963505)


Alignment Details
Target: chr5 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 18 - 126
Target Start/End: Complemental strand, 8963505 - 8963397
Alignment:
Q  18 tgcacgaaattgaagaagggaacgtgaaaaagcatagaattcaggtgatgacagacattgctttgcgagaaggtgcagtttattgttgctgtgaatcacc 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  8963505 tgcacgaaattgaagaagggaacgtgaaaaagcatagaattcaggtgatgacagacattgctttgcgagaaggtgcagtttattgttgctgtgaatcacc 8963406  T
Q  118 actctactc 126  Q
    |||||||||    
T  8963405 actctactc 8963397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University