View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14254_high_22 (Length: 231)

Name: NF14254_high_22
Description: NF14254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14254_high_22
NF14254_high_22
[»] chr6 (1 HSPs)
chr6 (11-146)||(10252386-10252521)


Alignment Details
Target: chr6 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 11 - 146
Target Start/End: Original strand, 10252386 - 10252521
Alignment:
Q  11 agagagaagaatctaacttcagaaattgtacaacatgaatcactttgctaagtttcatcttcatatttaatatttttatcttatgtgatcaccgtccatg 110  Q
    ||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
T  10252386 agagaaaagaatctaacttcagaaattgtacaacctgaatcactttgctaagtttcatcttcatatttaatatttttatctgatgtgatcaccgtccatg 10252485  T
Q  111 gcagaacaaaaagcatttaacattggccagccatac 146  Q
    ||||||||||||||||||||||||||||||||||||    
T  10252486 gcagaacaaaaagcatttaacattggccagccatac 10252521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University