View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14250_low_8 (Length: 221)

Name: NF14250_low_8
Description: NF14250
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14250_low_8
NF14250_low_8
[»] chr3 (1 HSPs)
chr3 (18-209)||(52730777-52730968)


Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 18 - 209
Target Start/End: Complemental strand, 52730968 - 52730777
Alignment:
Q  18 agaggccagctattactttcaactttctcttgcagttctttggtcttgcccttgtcgggtatgcaaattttcttttcccactcataacctacaaatcatt 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  52730968 agaggccagctattactttcaactttctcttgcagttctttggtcttgcccttgtcgggtatgcaaattttcttttcccactcataacctacaaatcatt 52730869  T
Q  118 agttagttaatttaaagtaaaataagaagaaaaatcgatggaaatcatggttttaaattgtgtttgtggttataccgtgaaactattatatt 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  52730868 agttagttaatttaaagtaaaataagaagaaaaatcgatggaaatcatggttttaaattgtgtttgtggttataccgtgaaactattatatt 52730777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University