View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14243_low_12 (Length: 334)

Name: NF14243_low_12
Description: NF14243
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14243_low_12
NF14243_low_12
[»] chr3 (1 HSPs)
chr3 (19-302)||(38666653-38666936)


Alignment Details
Target: chr3 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 19 - 302
Target Start/End: Original strand, 38666653 - 38666936
Alignment:
Q  19 agcgacgacgccgacggcttgggattcggagannnnnnnagtttcttcgcgggagagaattggagcgagagaggagaaatctttgagtgttcgttttgct 118  Q
    ||||||||||||||||||||||||||||||||       |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
T  38666653 agcgacgacgccgacggcttgggattcggagagagggggagtttcttcgcgggagagaattagagcgagagaggagaaatctttgagtgttcgttttgct 38666752  T
Q  119 ttgaggagattcttgcttggagcttcgtgtttagggttttgatttctggcggagatttggaagtggtggagaagtcgaggggcggcggtggccaccgtgc 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38666753 ttgaggagattcttgcttggagcttcgtgtttagggttttgatttctggcggagatttggaagtggtggagaagtcgaggggcggcggtggccaccgtgc 38666852  T
Q  219 gttggtggcggatgatggagaatgatgcgagcgacatcttgaaggagagagagaattgagatttcaaagccttttttgaaacgg 302  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38666853 gttggtggcggatgatggagaatgatgcgagcgacatcttgaaggagagagagaattgagatttcaaagccttttttgaaacgg 38666936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University