View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14236_low_63 (Length: 240)

Name: NF14236_low_63
Description: NF14236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14236_low_63
NF14236_low_63
[»] chr4 (1 HSPs)
chr4 (22-224)||(38791982-38792184)


Alignment Details
Target: chr4 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 22 - 224
Target Start/End: Original strand, 38791982 - 38792184
Alignment:
Q  22 attgattagttaaataattaatctaacatctttaagcttgtagcaattttatgcacgtgtttatcatttacttcatctttatttacagttctttagagaa 121  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38791982 attgattagttaaataattaatctaacatctttaagcttgtagcaattttatgcacgtgtttatcatttacttcatctttatttacagttctttagagaa 38792081  T
Q  122 acacatgataacttagattgaattcgtcacactggtttaattgtcnnnnnnnnnnnnctatgatggttgtctttgatgatacatcaatttaatgcatgca 221  Q
    |||||||||||||||||||||||||||||||||||||||||||||            ||||||||| |||||||||||||||||||||||||||||||||    
T  38792082 acacatgataacttagattgaattcgtcacactggtttaattgtcttttttgtctttctatgatggctgtctttgatgatacatcaatttaatgcatgca 38792181  T
Q  222 ttt 224  Q
    |||    
T  38792182 ttt 38792184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University