View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14236_high_64 (Length: 227)

Name: NF14236_high_64
Description: NF14236
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14236_high_64
NF14236_high_64
[»] chr3 (1 HSPs)
chr3 (16-221)||(36444996-36445201)


Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 16 - 221
Target Start/End: Original strand, 36444996 - 36445201
Alignment:
Q  16 ctcaacgactggaacaaaggcccacacttcaccagttacgtcgatttcgcccaactagcccagcccagcatatcaagcccatgggcttcatggtccaact 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  36444996 ctcaacgactggaacaaaggcccacacttcaccagttacgtcgatttcgcccaactagcccagcccagcatatcaagcccatgggcttcatggtccaact 36445095  T
Q  116 tccctcctccatctctctccgattgccgcaacaatctcaaccaatgcctcgaatccatggcggagaaagcactccgattaggatcccttacttctcgtca 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
T  36445096 tccctcctccatctctctccgattgccgcaacaatctcaaccaatgcctcgaatccatggcggagaaagcactccaattaggatcccttacttctcgtca 36445195  T
Q  216 gatctt 221  Q
    ||||||    
T  36445196 gatctt 36445201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University