View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14234_high_61 (Length: 223)

Name: NF14234_high_61
Description: NF14234
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14234_high_61
NF14234_high_61
[»] chr5 (2 HSPs)
chr5 (15-199)||(11859456-11859646)
chr5 (30-134)||(11827330-11827434)


Alignment Details
Target: chr5 (Bit Score: 112; Significance: 9e-57; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 15 - 199
Target Start/End: Original strand, 11859456 - 11859646
Alignment:
Q  15 aattgctactagacttgttttgaaattggaggagcttaatcaggaggaatcttggtcattgtttcagcagattcatggaccaattacttcagccaaaaaa 114  Q
    ||||||| |||||| ||||||||| ||| ||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
T  11859456 aattgctgctagacatgttttgaagttgcaggggcttaatcaagaggaatcttggtcattgtttcagcagattcatggaccaattacttcaaccaaaaaa 11859555  T
Q  115 gaacaaagcaccattgaacc------tgaacatgaacgggagatcgtggagggttgtggtggagttcctcttttgattgtgatcgtagcga 199  Q
    |  |||||||||| ||||||      ||||| |||||||||||| ||||| ||||||| ||||||||||||||||||||||||||||||||    
T  11859556 gtgcaaagcaccactgaacccgaacgtgaacctgaacgggagattgtggaaggttgtgctggagttcctcttttgattgtgatcgtagcga 11859646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 30 - 134
Target Start/End: Original strand, 11827330 - 11827434
Alignment:
Q  30 tgttttgaaattggaggagcttaatcaggaggaatcttggtcattgtttcagcagattcatggaccaattacttcagccaaaaaagaacaaagcaccatt 129  Q
    ||||||||| ||| ||| |||||||||  ||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||| ||||||||||||     
T  11827330 tgttttgaagttgcaggggcttaatcaaaaggaatcttggtcattgtttcagcagatttatggaccaattacttcaaccaaaaaagcacaaagcaccatc 11827429  T
Q  130 gaacc 134  Q
    |||||    
T  11827430 gaacc 11827434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University