View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1422_low_53 (Length: 235)

Name: NF1422_low_53
Description: NF1422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1422_low_53
NF1422_low_53
[»] chr4 (2 HSPs)
chr4 (129-218)||(50632290-50632382)
chr4 (13-69)||(50632174-50632230)


Alignment Details
Target: chr4 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 129 - 218
Target Start/End: Original strand, 50632290 - 50632382
Alignment:
Q  129 cacacaagttgatgttttcttcattttctctttcaactagaattcaag---agtgtgtttgtttttgttgaatgaatgaatgaccaatgtttt 218  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||   ||||||||||||||||| ||||||||||||||||||||||||    
T  50632290 cacacaagttgatgttttcttcattttctctttcaactacaattcaagagtagtgtgtttgtttttgtggaatgaatgaatgaccaatgtttt 50632382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 13 - 69
Target Start/End: Original strand, 50632174 - 50632230
Alignment:
Q  13 cataggtcataaaagggtgtctgtttgcatatttggtccaccaaatcatccttcatt 69  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  50632174 cataggtcataaaagggtgtctgtttgcatatttggtccaccaaatcatccttcatt 50632230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University