View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1422_high_20 (Length: 319)

Name: NF1422_high_20
Description: NF1422
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1422_high_20
NF1422_high_20
[»] chr7 (1 HSPs)
chr7 (97-302)||(34770839-34771044)
[»] chr2 (1 HSPs)
chr2 (105-151)||(8780692-8780738)


Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 97 - 302
Target Start/End: Complemental strand, 34771044 - 34770839
Alignment:
Q  97 ctaccaagtaatgatggggaagccaatgatcaacttcttaaatacataagttgttgcagtcgcatgtaacgaaggggccacaaccgtaacaattatgtaa 196  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||    
T  34771044 ctaccaagtaatgatggggaagccaatgatcaacttcttaaatacataagttgttgcagtcgcctgtaacgaagggtccacaaccgtaacaattatgtaa 34770945  T
Q  197 attcatattttatgggttttcttttggcacttgatcaatcattgtgtagttgttacttactaggtgtctacttatgtatttgcacacaaattgtaataca 296  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34770944 attcatattttatgggctttcttttggcacttgatcaatcattgtgtagttgttacttactaggtgtctacttatgtatttgcacacaaattgtaataca 34770845  T
Q  297 ttggct 302  Q
    ||||||    
T  34770844 ttggct 34770839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 105 - 151
Target Start/End: Original strand, 8780692 - 8780738
Alignment:
Q  105 taatgatggggaagccaatgatcaacttcttaaatacataagttgtt 151  Q
    |||||||| |||| ||||||||||||||||||| || ||||||||||    
T  8780692 taatgatgaggaaaccaatgatcaacttcttaattatataagttgtt 8780738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University