View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14229_low_56 (Length: 201)

Name: NF14229_low_56
Description: NF14229
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14229_low_56
NF14229_low_56
[»] chr1 (1 HSPs)
chr1 (20-178)||(45604333-45604497)
[»] chr6 (1 HSPs)
chr6 (39-161)||(20070142-20070264)


Alignment Details
Target: chr1 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 20 - 178
Target Start/End: Complemental strand, 45604497 - 45604333
Alignment:
Q  20 agagactcatcaaagcaccttaccaaaactattgtttgctgaatggctttcattggatcatgttaataata------ggaactcttcaaattcagttgaa 113  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||      |||||||||||||||||||||||    
T  45604497 agagactcatcaaagcaccttaccaaaactattgtttgctgaatggctttcattggatcatgttaataataataataggaactcttcaaattcagttgaa 45604398  T
Q  114 tctttggtcatgagaaatggatttgatcaaaattcagcttttcaagaagttacaatgcaagaagg 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  45604397 tctttggtcatgagaaatggatttgatcaaaattcagcttttcaagaagttacaatgcaagaagg 45604333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 39 - 161
Target Start/End: Original strand, 20070142 - 20070264
Alignment:
Q  39 ttaccaaaactattgtttgctgaatggctttcattggatcatgttaataataggaactcttcaaattcagttgaatctttggtcatgagaaatggatttg 138  Q
    ||||||||||| || ||| |||| ||||||||| | ||||| || |||  | | ||||||  |||||||| ||| ||||||||| ||| |||||| | ||    
T  20070142 ttaccaaaacttttattttctgagtggctttcactagatcaagtaaatggttgcaactctctaaattcagatgattctttggtcttgaaaaatggctatg 20070241  T
Q  139 atcaaaattcagcttttcaagaa 161  Q
    ||||||||| |  ||||||||||    
T  20070242 atcaaaatttaatttttcaagaa 20070264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University