View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14228_low_9 (Length: 332)

Name: NF14228_low_9
Description: NF14228
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14228_low_9
NF14228_low_9
[»] chr3 (2 HSPs)
chr3 (111-322)||(34630383-34630588)
chr3 (20-48)||(34630852-34630880)


Alignment Details
Target: chr3 (Bit Score: 137; Significance: 2e-71; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 111 - 322
Target Start/End: Complemental strand, 34630588 - 34630383
Alignment:
Q  111 tttgataagatattttcgataagatacgtctaggtcacacaacctaaaatttcgatatataacgtctaggtcactcaacgtnnnnnnnnnnnnngaaaat 210  Q
    |||||||||||||||| ||||||||| |||||||||||||||||||||||||||||| |||||||||||||||| ||||||             ||||||    
T  34630588 tttgataagatatttttgataagata-gtctaggtcacacaacctaaaatttcgatacataacgtctaggtcacgcaacgtaaaaaaa------gaaaat 34630496  T
Q  211 acatcatgttggtgcatagcaattaatctcaataaaactatatttattttgcaaataagctatc-attaattacacaatttacgatgaaatttattgccc 309  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
T  34630495 acatcatgtcggtgcatagcaattaatctcaataaaactatatttattttgcaaataagctatctattaattacacaatttacgatgaaatttattgccc 34630396  T
Q  310 agttttggttcat 322  Q
    |||||||||||||    
T  34630395 agttttggttcat 34630383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 20 - 48
Target Start/End: Complemental strand, 34630880 - 34630852
Alignment:
Q  20 atacgctctcaactaaaagtttaacttat 48  Q
    |||||||||||||||||||||||||||||    
T  34630880 atacgctctcaactaaaagtttaacttat 34630852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University