View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14227_low_21 (Length: 210)

Name: NF14227_low_21
Description: NF14227
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14227_low_21
NF14227_low_21
[»] chr2 (1 HSPs)
chr2 (1-199)||(30099516-30099718)


Alignment Details
Target: chr2 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 30099718 - 30099516
Alignment:
Q  1 ttgaggacctcctcttgctcccctctgtttattatcatattgtttattttttctttgttgttgttgtggttacctgcaccaacctacctgaacaatctgt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  30099718 ttgaggacctcctcttgctcccctctgtttattatcatattgtttattttttctttgttgttgttgtggttacctgcaccaacctacctgaacaatctgt 30099619  T
Q  101 cctttccactgtctggtacatgacc----ccttggttaaaacgtatgcagatgcgtttcattaatcatatccgaagtcgactattgctcatccacacagg 196  Q
    |||||||||||||||||||||||||    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||    
T  30099618 cctttccactgtctggtacatgacccctaccttggttaaaacgtatgcagatgcatttcattaatcatatccgaagtcgactattgctcatccatacagg 30099519  T
Q  197 ttc 199  Q
    |||    
T  30099518 ttc 30099516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University