View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14218_high_9 (Length: 329)

Name: NF14218_high_9
Description: NF14218
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14218_high_9
NF14218_high_9
[»] scaffold0114 (1 HSPs)
scaffold0114 (14-325)||(5675-5986)


Alignment Details
Target: scaffold0114 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: scaffold0114
Description:

Target: scaffold0114; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 14 - 325
Target Start/End: Complemental strand, 5986 - 5675
Alignment:
Q  14 aggtacgtgcggtctctaaacatatgtccattcttcatgatggggataatgtcatctcggacccaattgagatagaggaccatgttgtgtcatattttca 113  Q
    ||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
T  5986 aggtacgtgcggtttctaaacatatgtccattcttcatgatagggataatgtcatctcggacccaattgagatagaggagcatgttgtgtcatattttca 5887  T
Q  114 gtctatttttagcgttgataatgattgtggggctaataatatggtagagcaattggttccaagattggttacggaggctgagaatgatttattatgttgc 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |     
T  5886 gtctatttttagcgttgataatgattgtggggctaataatatggtagagcaattggttccaagattggttacggaggctgagactgatttattatgtcgt 5787  T
Q  214 ttacctgtgatgtctgaaataaagtctgcggtttttcatcttaatgatgatagtgcgccgggtccagacgggtttggtgggcatttttacaagacgtttt 313  Q
    |||||| ||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||| |||||||||||||||||||||||| |||| ||||    
T  5786 ttacctatgatgtctgaaataaagtctgcggtttttgatcttaatggtgatagtgcgccgggtcctgacgggtttggtgggcatttttactagacatttt 5687  T
Q  314 gggacattattt 325  Q
    ||||||||||||    
T  5686 gggacattattt 5675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University