View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14217_high_13 (Length: 231)

Name: NF14217_high_13
Description: NF14217
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14217_high_13
NF14217_high_13
[»] chr7 (1 HSPs)
chr7 (28-204)||(36526445-36526621)


Alignment Details
Target: chr7 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 28 - 204
Target Start/End: Complemental strand, 36526621 - 36526445
Alignment:
Q  28 agaattaccctcctacatgttgaatttcttgatcattctctctttannnnnnnaagacttttttatgtgttgtataaactaaatacttttatctttacct 127  Q
    ||||| ||||||||||||||||||||||||||||||| ||||||||       ||||||||||||||||||||||||| |||||||||||||||||||||    
T  36526621 agaatgaccctcctacatgttgaatttcttgatcattttctctttatttttttaagacttttttatgtgttgtataaaataaatacttttatctttacct 36526522  T
Q  128 tgatatttatggcatatatattcattgtagtaatctccnnnnnnnnnnnnggattcggtgttggtcaacatttatct 204  Q
    ||||||||||||||||||||||||||||||||||||||            |||||||||||||||||||||||||||    
T  36526521 tgatatttatggcatatatattcattgtagtaatctccttttttttttttggattcggtgttggtcaacatttatct 36526445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University