View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14212_high_7 (Length: 423)

Name: NF14212_high_7
Description: NF14212
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14212_high_7
NF14212_high_7
[»] chr6 (1 HSPs)
chr6 (18-75)||(33796235-33796292)


Alignment Details
Target: chr6 (Bit Score: 58; Significance: 3e-24; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 18 - 75
Target Start/End: Original strand, 33796235 - 33796292
Alignment:
Q  18 ataatcttctatgtttataagctattattaacctcgatttccaaagaatataggactt 75  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33796235 ataatcttctatgtttataagctattattaacctcgatttccaaagaatataggactt 33796292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University