View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14208_low_4 (Length: 363)

Name: NF14208_low_4
Description: NF14208
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14208_low_4
NF14208_low_4
[»] scaffold0194 (1 HSPs)
scaffold0194 (1-346)||(25759-26104)


Alignment Details
Target: scaffold0194 (Bit Score: 342; Significance: 0; HSPs: 1)
Name: scaffold0194
Description:

Target: scaffold0194; HSP #1
Raw Score: 342; E-Value: 0
Query Start/End: Original strand, 1 - 346
Target Start/End: Original strand, 25759 - 26104
Alignment:
Q  1 tacgaacagcttttgaagtatcgagttggcgaaacatcgggtgaaaacaacaacggaatggtggataattacatgcctcagacacaaacttcaggaggat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  25759 tacgaacagcttttgaagtatcgagttggcgaaacatcgggtgaaaacaacaacggaatggtggataattacatgcctcagacacaaacttcaggaggat 25858  T
Q  101 tttatggtgcaaattcttttgataaaatgagttttgcagatgtgatgcagtttgcagattttggacctaaattagccttaaaccgcgaagaatcaggtat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  25859 tttatggtgcaaattcttttgataaaatgagttttgcagatgtgatgcagtttgcagattttggacctaaattagccttaaaccgcgaagaatcaggtat 25958  T
Q  201 cgaagacccggtttattttctcaagtttcctgtcttaaacaataagatagaagaccaaaacttgatgttaagtggtgatgatgggttaggagaaaatgac 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  25959 cgaagacccggtttattttctcaagtttcctgtcttaaacaataagatagaagaccaaaacttgatgttaagtggtgatgatgggttaggagaaaatgac 26058  T
Q  301 gagaggttcaaattaacaagcttggaggataaatcaagagatcaac 346  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||    
T  26059 gagaggttcaaattaacaagcgtggaggataaatcaagagatcaac 26104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University