View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14194_low_29 (Length: 234)

Name: NF14194_low_29
Description: NF14194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14194_low_29
NF14194_low_29
[»] chr4 (1 HSPs)
chr4 (17-224)||(47616547-47616755)


Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 17 - 224
Target Start/End: Original strand, 47616547 - 47616755
Alignment:
Q  17 aagtaatatctgaatcttcttcaagatgggacccatctttggtttcaaccaataagaattgagtttctaatggaacttggcttcctttatctcccattct 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  47616547 aagtaatatctgaatcttcttcaagatgggacccatctttggtttcaaccaataagaattgagtttctaatggaacttggcttcctttatctcccattct 47616646  T
Q  117 ttgtgccatccaccatagcttgaaacggaaacatgccatgaatctaacatctgttaattttcc-gagtgaaactatgtgtctgctatctgaattatccat 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
T  47616647 ttgtgccatccaccatagcttgaaacggaaacatgccatgaatctaacatctgttaattttccagagtgaaactatgtgtctgctatctgaattatccat 47616746  T
Q  216 ctctgctcc 224  Q
     ||||||||    
T  47616747 ttctgctcc 47616755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University