View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14194_low_18 (Length: 303)

Name: NF14194_low_18
Description: NF14194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14194_low_18
NF14194_low_18
[»] chr5 (1 HSPs)
chr5 (31-285)||(18402449-18402703)


Alignment Details
Target: chr5 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 31 - 285
Target Start/End: Original strand, 18402449 - 18402703
Alignment:
Q  31 tgttaaattaagtggtgaccaaatatatagaggaaaaagaagatcaattgagatgatataaggaattgagagtaaacaatttagtgtcattgtatcatta 130  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||| || |||| |||||||||||||||||||||||||| |||||||||    
T  18402449 tgttaaattaagtggtgatcaaatatatagaggaaaaagaagatcaattgagatggtacaagggattgagagtaaacaatttagtgtcatggtatcatta 18402548  T
Q  131 aattttggatggttaaattataagttggtcaaaatttctgaaatggggaccaaaatcacgcaattaaaaacgacagaccaaaattatgctttggccaaaa 230  Q
    |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||    
T  18402549 aattttggatggttaaattataagttggtcaaaatttcagaaatggggaccaaaatcacggaattaaaaacgacagaccaaaattatggtttggccaaaa 18402648  T
Q  231 taagaaggtcaaaatagcatttaagcctaaaattaactatgcaacatggaaaaat 285  Q
    ||| ||| |||||||||||||||| ||||||||||||||||||||||||||||||    
T  18402649 taaaaagatcaaaatagcatttaaacctaaaattaactatgcaacatggaaaaat 18402703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University