View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14191_low_38 (Length: 206)

Name: NF14191_low_38
Description: NF14191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14191_low_38
NF14191_low_38
[»] chr4 (1 HSPs)
chr4 (19-190)||(54985958-54986129)
[»] chr2 (1 HSPs)
chr2 (60-175)||(7883510-7883625)
[»] chr3 (1 HSPs)
chr3 (62-173)||(18396534-18396645)


Alignment Details
Target: chr4 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 19 - 190
Target Start/End: Original strand, 54985958 - 54986129
Alignment:
Q  19 aggatgctgaatctgtattttgtttgactgatcttatctacgtttcagggtttatgggggctatgatatccaatgtggcctttgtgtttaggaatatatt 118  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  54985958 aggatgctgaatctgtattttgtttgactgatcttatctatgtttcagggtttatgggggctatgatatccaatgtggcctttgtgtttaggaatatatt 54986057  T
Q  119 ctcaaagaagggaatgaaaggaatgtctgttagtggaatgaactactatgcttgtctctccatattatctct 190  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  54986058 ctcaaagaagggaatgaaaggaatgtctgttagtggaatgaactactatgcttgtctctccatattatctct 54986129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 72; Significance: 6e-33; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 60 - 175
Target Start/End: Original strand, 7883510 - 7883625
Alignment:
Q  60 gtttcagggtttatgggggctatgatatccaatgtggcctttgtgtttaggaatatattctcaaagaagggaatgaaaggaatgtctgttagtggaatga 159  Q
    |||||||| |||||||| ||||||||||| ||| |||| ||||| ||||||||||||||||||||||| |||||||| ||||||  ||||||||||||||    
T  7883510 gtttcaggatttatgggagctatgatatcaaatttggcatttgtatttaggaatatattctcaaagaaaggaatgaatggaatgagtgttagtggaatga 7883609  T
Q  160 actactatgcttgtct 175  Q
    |||| |||||||||||    
T  7883610 actattatgcttgtct 7883625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 52; Significance: 5e-21; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 62 - 173
Target Start/End: Original strand, 18396534 - 18396645
Alignment:
Q  62 ttcagggtttatgggggctatgatatccaatgtggcctttgtgtttaggaatatattctcaaagaagggaatgaaaggaatgtctgttagtggaatgaac 161  Q
    |||||| |||||||||||||||||||| ||| |||| ||||||||  | || || ||||| || ||||| ||||| |||| ||||||||||||||||||     
T  18396534 ttcaggttttatgggggctatgatatcaaatctggcatttgtgttccgcaacatcttctcgaaaaaggggatgaagggaaagtctgttagtggaatgaat 18396633  T
Q  162 tactatgcttgt 173  Q
    ||||||||||||    
T  18396634 tactatgcttgt 18396645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University