View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14175_low_16 (Length: 204)

Name: NF14175_low_16
Description: NF14175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14175_low_16
NF14175_low_16
[»] chr5 (1 HSPs)
chr5 (17-187)||(18592665-18592836)


Alignment Details
Target: chr5 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 17 - 187
Target Start/End: Original strand, 18592665 - 18592836
Alignment:
Q  17 ttcttatgtgttaagtaaaaaatacttgtatcaatttacatagtacaatggagtgtgtctgaatttaatcgggttattccctatattatcaatggaaaac 116  Q
    ||||||||||||| |||||| ||||||| ||||||||||| ||| |||||| ||||||||||||| |||||||||||||||||||||||   | ||||||    
T  18592665 ttcttatgtgttatgtaaaatatacttgcatcaatttacaaagtccaatggtgtgtgtctgaattgaatcgggttattccctatattat-tttcgaaaac 18592763  T
Q  117 agtttcattacaaataatatgctaagcaa-ttgttgattctctgttttaga-tttcaaagttgaaatcaaaat 187  Q
    | ||||||||||||||||||||||||||| ||||||||||| | ||||||| |||| ||||||||||||||||    
T  18592764 aatttcattacaaataatatgctaagcaatttgttgattctttattttagattttcgaagttgaaatcaaaat 18592836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University