View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14158_low_14 (Length: 219)

Name: NF14158_low_14
Description: NF14158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14158_low_14
NF14158_low_14
[»] chr1 (1 HSPs)
chr1 (40-184)||(43094077-43094219)


Alignment Details
Target: chr1 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 40 - 184
Target Start/End: Complemental strand, 43094219 - 43094077
Alignment:
Q  40 cttcaacagaaacaattgttacagcaaggattgggtgtcagattatgtggggccctatacggattgtttgtagtaactcctaattttaacgttaatgaaa 139  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43094219 cttcaacagaaacaattgttacagcaaggattgggtgtcagattatgtggggccctatacggattgtttgtagtaactcctaattttaacgttaatgaaa 43094120  T
Q  140 acnnnnnnnnnncatctaacaatataacaacctcctttcgttgtc 184  Q
    ||          |||||||||||||||||||||||||||||||||    
T  43094119 ac--aaaaaaaccatctaacaatataacaacctcctttcgttgtc 43094077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University