View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14152_high_53 (Length: 232)

Name: NF14152_high_53
Description: NF14152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14152_high_53
NF14152_high_53
[»] chr5 (2 HSPs)
chr5 (57-214)||(39951238-39951395)
chr5 (1-54)||(39950884-39950937)
[»] chr1 (2 HSPs)
chr1 (59-213)||(46402616-46402769)
chr1 (1-52)||(46402247-46402298)


Alignment Details
Target: chr5 (Bit Score: 134; Significance: 7e-70; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 57 - 214
Target Start/End: Original strand, 39951238 - 39951395
Alignment:
Q  57 atagcttttgtttttagctgtggcttttacagtaagaattgatgcgtatttcttatctgacgatactgagttttggttgcattcatagctgatcctggag 156  Q
    ||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||    
T  39951238 atagcttttgtttttagctgtggcttttacagtaagacttgatgcgcatttcttatctgacgatactgagttttggttgcagtcatagctgatcctggag 39951337  T
Q  157 ggggtatcttctatactgatcgaagaaaccagcaggggggcatgtgctagctcatgcg 214  Q
    | |||||||||  |||||||||||||||||||||||||||||||||||||||||||||    
T  39951338 gtggtatcttcattactgatcgaagaaaccagcaggggggcatgtgctagctcatgcg 39951395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 54
Target Start/End: Original strand, 39950884 - 39950937
Alignment:
Q  1 tggtgagatgttactcatagagtagtatagagttgccttccgttgcaatatcgt 54  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  39950884 tggtgagatgttactcatagagtagtatagagttgccttccgttgcaatatcgt 39950937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 69; Significance: 4e-31; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 59 - 213
Target Start/End: Original strand, 46402616 - 46402769
Alignment:
Q  59 agcttttgtttttagctgtggcttttacagtaagaattgatgcgtatttcttatctgacgatactgagttttggttgcattcatagctgatcctggaggg 158  Q
    |||||| ||||| ||||||||||||||   |||||   ||||||| || ||||| ||| |||||||||||||||||||| ||||||||||||| |||||     
T  46402616 agctttagttttaagctgtggcttttat--taagaccagatgcgtcttgcttatgtgatgatactgagttttggttgcagtcatagctgatccaggaggt 46402713  T
Q  159 ggtatcttctatactgat-cgaagaaaccagcaggggggcatgtgctagctcatgc 213  Q
    ||||| |||  ||||||| | |||||||||||||||||||||||||||||||||||    
T  46402714 ggtatgttcattactgatccaaagaaaccagcaggggggcatgtgctagctcatgc 46402769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 46402247 - 46402298
Alignment:
Q  1 tggtgagatgttactcatagagtagtatagagttgccttccgttgcaatatc 52  Q
    ||||||||||||||||||||||| |||||||||| |||||||||||||||||    
T  46402247 tggtgagatgttactcatagagtggtatagagtttccttccgttgcaatatc 46402298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University