View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14148_low_17 (Length: 221)

Name: NF14148_low_17
Description: NF14148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14148_low_17
NF14148_low_17
[»] chr8 (1 HSPs)
chr8 (1-221)||(40404349-40404564)
[»] chr3 (1 HSPs)
chr3 (8-115)||(45317632-45317739)


Alignment Details
Target: chr8 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 40404564 - 40404349
Alignment:
Q  1 tgacaaatgcatagtagatccaaagcattgcactgaaaagtgccacaacataaggaagtgcctgaaatccttcagcagatttcttcttgaagattacgta 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40404564 tgacaaatgcatagtagatccaaagcattgcactgaaaagtgccacaacataaggaagtgcctgaaatccttcagcagatttcttcttgaagattacgta 40404465  T
Q  101 aaaagttggcctgcaannnnnnnnnnnnnnnnnnncgtttaggaaatta-----tcacttcactttgttcaattaatttacaagaaaacaaaatggttac 195  Q
    ||||||||||||||||                   ||||||| ||||||     ||||||||||||||||||||||||||||||||||||||||||||||    
T  40404464 aaaagttggcctgcaa----------atatatatacgtttagtaaattatcacttcacttcactttgttcaattaatttacaagaaaacaaaatggttac 40404375  T
Q  196 ttacaatggtgagaggaacaccgcaa 221  Q
    ||||||||||||||||||||||||||    
T  40404374 ttacaatggtgagaggaacaccgcaa 40404349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 8 - 115
Target Start/End: Complemental strand, 45317739 - 45317632
Alignment:
Q  8 tgcatagtagatccaaagcattgcactgaaaagtgccacaacataaggaagtgcctgaaatccttcagcagatttcttcttgaagattacgtaaaaagtt 107  Q
    |||||| |||||||||||||||||||| || | |||   ||||||||||| ||  ||||| ||||||| ||||||||||||| |||||  |||||| |||    
T  45317739 tgcataatagatccaaagcattgcactcaacaatgcagtaacataaggaactgattgaaacccttcagtagatttcttcttgtagattcggtaaaatgtt 45317640  T
Q  108 ggcctgca 115  Q
    || |||||    
T  45317639 ggtctgca 45317632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University