View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14146_high_33 (Length: 213)

Name: NF14146_high_33
Description: NF14146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14146_high_33
NF14146_high_33
[»] chr8 (1 HSPs)
chr8 (19-194)||(2160870-2161045)


Alignment Details
Target: chr8 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 19 - 194
Target Start/End: Original strand, 2160870 - 2161045
Alignment:
Q  19 agactttggtatatgccagcaaaattgaggagataaggttgagtttgggattcggattcgatgcagcatttgcacttgacagaatgagaagaattggtgg 118  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
T  2160870 agactttggtatatgccagcaaaattgaggagataaggttgagtttgggattcggattcgatgcagcatttgcacttgacagaatgagaagaatcggtgg 2160969  T
Q  119 gttttgaatggtcgctacaatggcactcatcaaattttattgacctggatgacactttacatgtttctatcgtttc 194  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  2160970 gttttgaatggtcgctacaatggcactcatcaaattttattgacctggatgacactttacatgtttctatcgtttc 2161045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University