View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14145_low_52 (Length: 231)

Name: NF14145_low_52
Description: NF14145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14145_low_52
NF14145_low_52
[»] chr6 (2 HSPs)
chr6 (13-161)||(32047556-32047704)
chr6 (182-215)||(32047495-32047528)


Alignment Details
Target: chr6 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 13 - 161
Target Start/End: Complemental strand, 32047704 - 32047556
Alignment:
Q  13 gcaaaggatgcaagatgtcatgtgatgtcatcttagctggttttgatgatgtcacctcatttcttgtgtagtacgatcaaaatgttttggagaatgttct 112  Q
    |||| ||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||| |    
T  32047704 gcaatggatgcaagctgtcatgtgatgtcatcttagctggttttgatgatgtcatctcatttcttgtgtagtacgatcaaaaggttttggagaatgttat 32047605  T
Q  113 ggtctatgcttgatatcattctcgacaaaacaaatcttgttttaagtcc 161  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||||    
T  32047604 ggtctatgcttgagatcattctcgacaaaacaaatcttgttttaagtcc 32047556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 182 - 215
Target Start/End: Complemental strand, 32047528 - 32047495
Alignment:
Q  182 ggaagagattaataatggtggaaaacaataaaat 215  Q
    ||||||||||||||||||||||||||||||||||    
T  32047528 ggaagagattaataatggtggaaaacaataaaat 32047495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University