View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14143_low_27 (Length: 238)

Name: NF14143_low_27
Description: NF14143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14143_low_27
NF14143_low_27
[»] chr7 (1 HSPs)
chr7 (10-221)||(46959550-46959761)
[»] chr2 (1 HSPs)
chr2 (160-205)||(44522410-44522455)


Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 10 - 221
Target Start/End: Original strand, 46959550 - 46959761
Alignment:
Q  10 acatgattataatcgatgaaaattatgaaatcagctattatattctacaaatcataaagacaattcaaaactatattggctatctcctcagataaataaa 109  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  46959550 acatgattataattgatgaaaattatgaaatcagctattatattctacaaatcataaagacaattcaaaactatattggctatctcctcagataaataaa 46959649  T
Q  110 tacaactattaataatgtgtcactgcatgcacatgtagacttacaaaacgaccctgcaaaaatatcttaaaattcaatacctgattcttgcatggaattc 209  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||    
T  46959650 tacaactattaataatgtgtcactgcatgcacatgtagacttgcaaaatgaccctgcaaaaatatcttaaaattcaatacctgattcttgcatggaagtc 46959749  T
Q  210 gggaatcacagt 221  Q
    ||||||||||||    
T  46959750 gggaatcacagt 46959761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 160 - 205
Target Start/End: Complemental strand, 44522455 - 44522410
Alignment:
Q  160 accctgcaaaaatatcttaaaattcaatacctgattcttgcatgga 205  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
T  44522455 accctgcaaaaatatcttaaaattcaatacctgattcttgcatgga 44522410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University