View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14138_low_34 (Length: 324)

Name: NF14138_low_34
Description: NF14138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14138_low_34
NF14138_low_34
[»] chr4 (1 HSPs)
chr4 (1-314)||(36051838-36052151)


Alignment Details
Target: chr4 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 1 - 314
Target Start/End: Complemental strand, 36052151 - 36051838
Alignment:
Q  1 gcatgatccctcgtgggcagtttatcgaacatgttccttgcgccggtgatagtaataacctctctggaacaaaaatgaaaagcacagtccctcttgggaa 100  Q
    |||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
T  36052151 gcatgatccctcgtgggcagtttatcgaacatgttcctcgcgacggtgatagtaataacttctctggaacaaaaatgaaaagcacagtccctcttgggaa 36052052  T
Q  101 atttatcaaacaagttcgtcgtactgataaaagtgactacagtggctgggaatggatgtttcgatggacctgggtcatatggttcagtgtcagtgattga 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  36052051 atttatcaaacaagttcgtcgtactgataaaagtgactacagtggctgggaatggatgtttcgatggacctgggtcatatggttcagtgtcagtgattga 36051952  T
Q  201 tgcaaacataacaatgctggattttgtcgactctgccaataacagcacagggttactcttagatgggtcattatctggcggctttggtggaggcggtggg 300  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  36051951 tgcaaacataacaatgctggattttgttgactctgccaataacagcacagggttactcttagatgggtcattatctggcggctttggtggaggcggtggg 36051852  T
Q  301 ggaacggcgaagcc 314  Q
    ||||||||||||||    
T  36051851 ggaacggcgaagcc 36051838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University