View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14131_low_19 (Length: 239)

Name: NF14131_low_19
Description: NF14131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14131_low_19
NF14131_low_19
[»] chr3 (13 HSPs)
chr3 (1-174)||(42770061-42770234)
chr3 (35-162)||(42772327-42772453)
chr3 (15-162)||(42770173-42770316)
chr3 (76-162)||(42772772-42772857)
chr3 (9-162)||(42772804-42772954)
chr3 (1-66)||(42772323-42772388)
chr3 (16-125)||(42770703-42770811)
chr3 (81-148)||(42772963-42773029)
chr3 (1-77)||(42770058-42770135)
chr3 (68-124)||(42772452-42772508)
chr3 (136-174)||(42772002-42772040)
chr3 (33-77)||(42771999-42772043)
chr3 (1-77)||(42772982-42773058)


Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 13)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 1 - 174
Target Start/End: Complemental strand, 42770234 - 42770061
Alignment:
Q  1 accttcaaccacgaaaccttcttgaacgttcctagagttttcttcttcctctttctcaccttcaaccgcagaaccttttggaaccttcttagagatttca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  42770234 accttcaaccacgaaaccttcttgaacgttcctagagttttcttcttcctctttctcaccttcaaccgcagaaccttttggaaccttcttagagatttca 42770135  T
Q  101 ccttcagccacaaaaccttcttgaacgtttttagaagttttcttcttccgctttctcacctttagctgcagaac 174  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
T  42770134 ccttcagccacaaaaccttcttgaacgtttttaaaagttttcttcttccgctttctcacctttagctgcagaac 42770061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 35 - 162
Target Start/End: Complemental strand, 42772453 - 42772327
Alignment:
Q  35 gagttttcttcttcctctttctcaccttcaaccgcagaaccttttggaaccttcttagagatttcaccttcagccacaaaaccttcttgaacgtttttag 134  Q
    |||||||||||||||||||||||||||||  ||||| |||||| ||||||| ||| | |||||||||||||||||||  ||||||||| |||||| ||||    
T  42772453 gagttttcttcttcctctttctcaccttcggccgcaaaaccttctggaaccgtctcaaagatttcaccttcagccacggaaccttctttaacgttcttag 42772354  T
Q  135 aagttttcttcttccgctttctcacctt 162  Q
     |||||||||||||||||||| ||||||    
T  42772353 -agttttcttcttccgctttcccacctt 42772327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 15 - 162
Target Start/End: Complemental strand, 42770316 - 42770173
Alignment:
Q  15 aaccttcttgaacgttcctagagttttcttcttcctctttctcaccttcaaccgcagaaccttttggaaccttcttagagatttcaccttcagccacaaa 114  Q
    |||||||||||| |||| ||||||||| |||| |   |||||||||||||||||||||||||| |  |||  | |||||| | ||||||||| |||| ||    
T  42770316 aaccttcttgaatgttcttagagtttttttctgc---tttctcaccttcaaccgcagaaccttctcaaactgtattagaggtctcaccttcaaccacgaa 42770220  T
Q  115 accttcttgaacgtttttagaagttttcttcttccgctttctcacctt 162  Q
    |||||||||||||||  ||| |||||||||||||| ||||||||||||    
T  42770219 accttcttgaacgttcctag-agttttcttcttcctctttctcacctt 42770173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 76 - 162
Target Start/End: Original strand, 42772772 - 42772857
Alignment:
Q  76 ttttggaaccttcttagagatttcaccttcagccacaaaaccttcttgaacgtttttagaagttttcttcttccgctttctcacctt 162  Q
    ||||||||||||||||||||||||||||| ||||||||||||||| | |||||| |||| |||||||||||||| ||||||| ||||    
T  42772772 ttttggaaccttcttagagatttcacctttagccacaaaaccttcatcaacgttcttag-agttttcttcttcccctttctcgcctt 42772857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 9 - 162
Target Start/End: Original strand, 42772804 - 42772954
Alignment:
Q  9 ccacgaaaccttcttgaacgttcctagagttttcttcttcctctttctcaccttcaaccgcagaaccttttggaaccttcttagagatttcaccttcagc 108  Q
    |||| |||||||| | ||||||| ||||||||||||||||| ||||||| |||||  ||  | |||||| ||||||| ||| | |||||| || ||||||    
T  42772804 ccacaaaaccttcatcaacgttcttagagttttcttcttcccctttctcgccttcggccaaaaaaccttatggaaccatctcatagatttgactttcagc 42772903  T
Q  109 cacaaaaccttcttgaacgtttttagaagttttcttcttccgctttctcacctt 162  Q
    ||||||| ||| |||| |||| ||   ||||||||||| ||||||| |||||||    
T  42772904 cacaaaatctttttgatcgttctt---agttttcttctcccgctttgtcacctt 42772954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 66
Target Start/End: Complemental strand, 42772388 - 42772323
Alignment:
Q  1 accttcaaccacgaaaccttcttgaacgttcctagagttttcttcttcctctttctcaccttcaac 66  Q
    ||||||| ||||| ||||||||| ||||||| ||||||||||||||||| ||||| ||||||||||    
T  42772388 accttcagccacggaaccttctttaacgttcttagagttttcttcttccgctttcccaccttcaac 42772323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 16 - 125
Target Start/End: Original strand, 42770703 - 42770811
Alignment:
Q  16 accttcttgaacgttcctagagttttcttcttcctctttctcaccttcaaccgcagaaccttttggaaccttcttagagatttcaccttcagccacaaaa 115  Q
    ||||| || ||| ||| ||||| |||||||| || ||||||||||||||||| || || ||| || ||| |||| |||||||||||||||||||||| ||    
T  42770703 accttatttaacattcttagagctttcttct-ccgctttctcaccttcaaccacaaaatcttgtgaaacattctaagagatttcaccttcagccacataa 42770801  T
Q  116 ccttcttgaa 125  Q
      ||||||||    
T  42770802 gtttcttgaa 42770811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 81 - 148
Target Start/End: Original strand, 42772963 - 42773029
Alignment:
Q  81 gaaccttcttagagatttcaccttcagccacaaaaccttcttgaacgtttttagaagttttcttcttc 148  Q
    |||||||||  || ||||||||||||||||||||| ||||||||| ||| |||| |||||||||||||    
T  42772963 gaaccttctcggatatttcaccttcagccacaaaagcttcttgaatgttcttag-agttttcttcttc 42773029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 77
Target Start/End: Complemental strand, 42770135 - 42770058
Alignment:
Q  1 accttcaaccacgaaaccttcttgaacgttcctaga-gttttcttcttcctctttctcaccttcaaccgcagaacctt 77  Q
    ||||||| |||| |||||||||||||||||  || | ||||||||||||| |||||||||||| | | ||||||||||    
T  42770135 accttcagccacaaaaccttcttgaacgtttttaaaagttttcttcttccgctttctcacctttagctgcagaacctt 42770058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 68 - 124
Target Start/End: Complemental strand, 42772508 - 42772452
Alignment:
Q  68 gcagaaccttttggaaccttcttagagatttcaccttcagccacaaaaccttcttga 124  Q
    |||||||||| | ||||||||| | || ||||||||||||||||| |||||||||||    
T  42772508 gcagaaccttctagaaccttctcaaaggtttcaccttcagccacagaaccttcttga 42772452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 136 - 174
Target Start/End: Complemental strand, 42772040 - 42772002
Alignment:
Q  136 agttttcttcttccgctttctcacctttagctgcagaac 174  Q
    |||||||| |||||||||||||||||| |||||||||||    
T  42772040 agttttctgcttccgctttctcaccttcagctgcagaac 42772002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 33 - 77
Target Start/End: Complemental strand, 42772043 - 42771999
Alignment:
Q  33 tagagttttcttcttcctctttctcaccttcaaccgcagaacctt 77  Q
    ||||||||||| ||||| |||||||||||||| | ||||||||||    
T  42772043 tagagttttctgcttccgctttctcaccttcagctgcagaacctt 42771999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 77
Target Start/End: Original strand, 42772982 - 42773058
Alignment:
Q  1 accttcaaccacgaaaccttcttgaacgttcctagagttttcttcttcctctttctcaccttcaaccgcagaacctt 77  Q
    ||||||| |||| ||| ||||||||| |||| ||||||||||||||||  ||||| || ||||| |  |||||||||    
T  42772982 accttcagccacaaaagcttcttgaatgttcttagagttttcttcttctactttcccagcttcagcaacagaacctt 42773058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University