View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14124_low_9 (Length: 452)

Name: NF14124_low_9
Description: NF14124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14124_low_9
NF14124_low_9
[»] chr4 (2 HSPs)
chr4 (319-450)||(36202775-36202906)
chr4 (319-433)||(35922158-35922272)


Alignment Details
Target: chr4 (Bit Score: 120; Significance: 3e-61; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 120; E-Value: 3e-61
Query Start/End: Original strand, 319 - 450
Target Start/End: Original strand, 36202775 - 36202906
Alignment:
Q  319 ctcaaagtgtaaacgtatctgtgaacatgcttttcaccttcttagttgcacaagttttcttgataatgctatgtcacatgaagtttggtttgttcctctt 418  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
T  36202775 ctcaaagtgtaaacgtatctgtgaacatgcttttcaccttcttagttgcacaagttttcttgataatgctttgtcacatgaagtttggtttgttcctctt 36202874  T
Q  419 ctttgccttctttgttttgatgatgtccatct 450  Q
    ||||||||||||||||||| ||||||| ||||    
T  36202875 ctttgccttctttgttttggtgatgtcaatct 36202906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 319 - 433
Target Start/End: Complemental strand, 35922272 - 35922158
Alignment:
Q  319 ctcaaagtgtaaacgtatctgtgaacatgcttttcaccttcttagttgcacaagttttcttgataatgctatgtcacatgaagtttggtttgttcctctt 418  Q
    |||||||||| || ||||||||||||||| ||||||| ||||| ||||||||||||||||| |   |||| ||||||||||||||||| |||||  ||||    
T  35922272 ctcaaagtgtcaatgtatctgtgaacatgtttttcacattctttgttgcacaagttttcttaaccctgctctgtcacatgaagtttggcttgtttatctt 35922173  T
Q  419 ctttgccttctttgt 433  Q
    |||||||||||||||    
T  35922172 ctttgccttctttgt 35922158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University