View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14121_low_7 (Length: 501)

Name: NF14121_low_7
Description: NF14121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14121_low_7
NF14121_low_7
[»] scaffold0003 (1 HSPs)
scaffold0003 (329-499)||(79699-79869)


Alignment Details
Target: scaffold0003 (Bit Score: 147; Significance: 3e-77; HSPs: 1)
Name: scaffold0003
Description:

Target: scaffold0003; HSP #1
Raw Score: 147; E-Value: 3e-77
Query Start/End: Original strand, 329 - 499
Target Start/End: Original strand, 79699 - 79869
Alignment:
Q  329 aagaattcctgcagaaagaagatgcacctgcagatgttgctgtcccaacagcaaatttccatcagcgaaatggatctcgaaattcccgtgggcgaggttc 428  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  79699 aagaattcctgcagaaagaagatgcacctgcagatgttgctgtcccaatagcaaatttccatcagcgaaatggatctcgaaattcccgtgggcgaggttc 79798  T
Q  429 ttttcgtcgaggcggtcgtcatggatcaaaccataatatgaatccttttccagcagattcatctcactcga 499  Q
    |||||||| |||||||||||||||||||||||| |||||||||||||||||| |||||||||  |||||||    
T  79799 ttttcgtccaggcggtcgtcatggatcaaaccaaaatatgaatccttttccaacagattcattccactcga 79869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University