View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14120_high_14 (Length: 228)

Name: NF14120_high_14
Description: NF14120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14120_high_14
NF14120_high_14
[»] chr5 (1 HSPs)
chr5 (13-209)||(8402638-8402834)


Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 13 - 209
Target Start/End: Complemental strand, 8402834 - 8402638
Alignment:
Q  13 gcagagagcagctagtatgccaactaaaaagggtttcactttaacaacatgattcttcgttccattgaatataaaacacatgattcatcgtttcataatt 112  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
T  8402834 gcagagagcagctagtatgccaactaaaaagggtttcactttaacaacatgattcttcgttccattgaatataaaacacatgattcatcgtttcataact 8402735  T
Q  113 atgcagtaattgaacaatggtcgatctagcaataagtggtttagcaatgccagtaattgctcacaagcctgcttgcttaattgggttgagtaggagt 209  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  8402734 atgcagtaattgaacaatggtcgatctagcaataagtggtttagcaatgccagtaattgctcacaagcctgcttgcttaattgggttgagtaggagt 8402638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University