View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14118_low_30 (Length: 272)

Name: NF14118_low_30
Description: NF14118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14118_low_30
NF14118_low_30
[»] chr2 (1 HSPs)
chr2 (17-262)||(10619582-10619827)


Alignment Details
Target: chr2 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 17 - 262
Target Start/End: Original strand, 10619582 - 10619827
Alignment:
Q  17 acatggaagacaccggaacaaccgttgatggcgtttgagacggcggtggagtcgaggatgttaacggggaagatggtgatgcgagattgggcttcgtggt 116  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
T  10619582 acatggaagacaccggaacaaccgttgatggcgtttgagacggcggtggagtcgaggatgttaacggggaagatggtgatgcgagattgggcttcggggt 10619681  T
Q  117 ggagtgtgaaaagatgagatgggtcggaattggggaagattgtagcgtggattttgtagtgtgggttttgtttagataatagggtgtgaactagccatga 216  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  10619682 ggagtgtgaaaagatgagatggatcggaattggggaagattgtagcgtggattttgtagtgtgggttttgtttagataatagggtgtgaactagccatga 10619781  T
Q  217 tccgatgaatccgtttgctccggttacgcataccacctcttctctg 262  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
T  10619782 tccgatgaatccgtttgctccggttacgcataccacctcttctctg 10619827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University