View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14117_low_74 (Length: 270)

Name: NF14117_low_74
Description: NF14117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14117_low_74
NF14117_low_74
[»] chr8 (1 HSPs)
chr8 (95-214)||(43196072-43196191)
[»] chr5 (1 HSPs)
chr5 (95-199)||(43191631-43191735)
[»] chr6 (1 HSPs)
chr6 (223-270)||(19106192-19106237)


Alignment Details
Target: chr8 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 95 - 214
Target Start/End: Complemental strand, 43196191 - 43196072
Alignment:
Q  95 aagataatcagctatgtcagttgaacaagtagggcatttcataatgtttttccgtctctgcaaactgcgaccactttgagatgccctcttcctgatgtaa 194  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| ||  || || |||||  ||| |||||||| |||||||| ||||| || |||    
T  43196191 aagataatcagctatgtcagttgaacaagtagggcatttcataatgttcttttgtgtccgcaaagcgcggccactttgggatgccctattcctaatataa 43196092  T
Q  195 ctttgtacagaaaaagcacc 214  Q
    |||||  ||||||| |||||    
T  43196091 ctttggccagaaaaggcacc 43196072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 95 - 199
Target Start/End: Original strand, 43191631 - 43191735
Alignment:
Q  95 aagataatcagctatgtcagttgaacaagtagggcatttcataatgtttttccgtctctgcaaactgcgaccactttgagatgccctcttcctgatgtaa 194  Q
    |||||| |||||||||||||||| ||| | ||| |||||||||||||| ||| || || |||||||||| |||||||||| || ||| |||||||| ||     
T  43191631 aagatactcagctatgtcagttgcacaggaaggacatttcataatgttcttctgtgtccgcaaactgcgtccactttgagttgtcctgttcctgatatag 43191730  T
Q  195 ctttg 199  Q
    |||||    
T  43191731 ctttg 43191735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 223 - 270
Target Start/End: Complemental strand, 19106237 - 19106192
Alignment:
Q  223 tcgtatctcactcctagtttaggagcataagagaggaacgtttttccc 270  Q
    |||||||||||||||||||||||||||||  |||||||||||||||||    
T  19106237 tcgtatctcactcctagtttaggagcata--agaggaacgtttttccc 19106192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University