View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14114_low_7 (Length: 223)

Name: NF14114_low_7
Description: NF14114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14114_low_7
NF14114_low_7
[»] chr2 (1 HSPs)
chr2 (16-176)||(6284007-6284167)


Alignment Details
Target: chr2 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 16 - 176
Target Start/End: Complemental strand, 6284167 - 6284007
Alignment:
Q  16 attatactattatataaaattttaaacaattatagatttcaaattgttcaaaacaacttctaaattctccaacatctcaaacctcgaatattttagggtt 115  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
T  6284167 attatactattatataaaattttaaacaattatagattttaaattgttcaaaacaacttttaaattctccaacatctcaaacctcgaatattttagggtt 6284068  T
Q  116 ttatttagttatacggactacccacaatctatgtgggctagcctaaattcaaaacagattc 176  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  6284067 ttatttagttatacggactacccacaatctatgtgggctagcctaaattcaaaacagattc 6284007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University