View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14111_low_16 (Length: 260)

Name: NF14111_low_16
Description: NF14111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14111_low_16
NF14111_low_16
[»] chr6 (2 HSPs)
chr6 (18-258)||(30497410-30497650)
chr6 (18-258)||(30504952-30505185)


Alignment Details
Target: chr6 (Bit Score: 241; Significance: 1e-133; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 18 - 258
Target Start/End: Complemental strand, 30497650 - 30497410
Alignment:
Q  18 ggttttaattggttggatggttttttggagcgcttatggtgagtagcagccgttaggatattagattttgtctatgtggtcatttgcgaggaagtgtgga 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  30497650 ggttttaattggttggatggttttttggagcgcttatggtgagtagcagccgttaggatattagattttgtctatgtggtcatttgcgaggaagtgtgga 30497551  T
Q  118 tgtttggatttgatttaggtgttgatgtcagtttttggtggttagtttttcttatttgtgttggtgctacctgtggtgtttgtattgatgtttttatgag 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  30497550 tgtttggatttgatttaggtgttgatgtcagtttttggtggttagtttttcttatttgtgttggtgctacctgtggtgtttgtattgatgtttttatgag 30497451  T
Q  218 tttctttttggatattccacctatatagaacacctttgctt 258  Q
    |||||||||||||||||||||||||||||||||||||||||    
T  30497450 tttctttttggatattccacctatatagaacacctttgctt 30497410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 18 - 258
Target Start/End: Complemental strand, 30505185 - 30504952
Alignment:
Q  18 ggttttaattggttggatggttttttggagcgcttatggtgagtagcagccgttaggatattagattttgtctatgtggtcatttgcgaggaagtgtgga 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||       |||||||||| ||||||| |||||||||||||||    
T  30505185 ggttttaattggttggatggttttttggagcgcttatggtgagtagcagctgttaggat-------tttgtctatgcggtcattcgcgaggaagtgtgga 30505093  T
Q  118 tgtttggatttgatttaggtgttgatgtcagtttttggtggttagtttttcttatttgtgttggtgctacctgtggtgtttgtattgatgtttttatgag 217  Q
     ||||||||||||||||||||||||| || |||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |  |    
T  30505092 ggtttggatttgatttaggtgttgatttcggtttttggtgattagtttttcttatttgtgttggtgctacccgtggtgtttgtattgatgtttttgtagg 30504993  T
Q  218 tttctttttggatattccacctatatagaacacctttgctt 258  Q
     |||||||| ||| |||||||||||||||||  ||||||||    
T  30504992 cttcttttttgatgttccacctatatagaacgtctttgctt 30504952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University