View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1411-Insertion-9 (Length: 113)

Name: NF1411-Insertion-9
Description: NF1411
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1411-Insertion-9
NF1411-Insertion-9
[»] chr7 (1 HSPs)
chr7 (5-113)||(34770740-34770847)


Alignment Details
Target: chr7 (Bit Score: 97; Significance: 4e-48; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 97; E-Value: 4e-48
Query Start/End: Original strand, 5 - 113
Target Start/End: Complemental strand, 34770847 - 34770740
Alignment:
Q  5 acattggctatattgttgtaataccttgccttggtttggcaccatttcaccaccaaagaacacttacaatcttgcatagtgtttcaatatagttttcttc 104  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||    
T  34770847 acattggctatattgttgtaataccttgccttggtttggcaccatttcaccaccaaagaacacttagaatcttgcatagtgtttcaata-agttttcttc 34770749  T
Q  105 ttttatttt 113  Q
    |||||||||    
T  34770748 ttttatttt 34770740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University