View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14104_low_11 (Length: 260)

Name: NF14104_low_11
Description: NF14104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14104_low_11
NF14104_low_11
[»] chr1 (2 HSPs)
chr1 (154-249)||(39521212-39521307)
chr1 (35-88)||(39521370-39521423)


Alignment Details
Target: chr1 (Bit Score: 92; Significance: 9e-45; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 154 - 249
Target Start/End: Complemental strand, 39521307 - 39521212
Alignment:
Q  154 gatgagtcttttaagaaaacctagttcaaatcttagttaaaacaaatttttaatcggactttacatatcaaataataataatctatacaaatatat 249  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  39521307 gatgagtcttttaagaaaacctagttcaaatcttagttaaaacaaatttttaattggactttacatatcaaataataataatctatacaaatatat 39521212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 35 - 88
Target Start/End: Complemental strand, 39521423 - 39521370
Alignment:
Q  35 tatgacataagagatctaactaaagtaacgtggcagaagcaatgagtatggtgg 88  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  39521423 tatgacataagagatctaactaaagtaacgtggcagaagcaatgagtatggtgg 39521370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University