View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1408_low_75 (Length: 365)

Name: NF1408_low_75
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1408_low_75
NF1408_low_75
[»] chr2 (1 HSPs)
chr2 (100-230)||(20039445-20039570)


Alignment Details
Target: chr2 (Bit Score: 87; Significance: 1e-41; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 100 - 230
Target Start/End: Complemental strand, 20039570 - 20039445
Alignment:
Q  100 tcagttgagacatattgacctttttgttgtttcttgtgataagtaggacactcagacatgagatgaccatatccatcacagccaaaacactgtaaacctc 199  Q
    ||||||||||||||||||||||||| |||||||||| |||||||||||||||| ||  ||||||||||||||||||||||||||||||| ||||||||||    
T  20039570 tcagttgagacatattgacctttttattgtttcttgagataagtaggacactcggagttgagatgaccatatccatcacagccaaaacattgtaaacctc 20039471  T
Q  200 tcccttgtctaggttgatcttcagttttcgt 230  Q
    |||     |||||||||||||||||||||||    
T  20039470 tcc-----ctaggttgatcttcagttttcgt 20039445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University